Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGACGTGGCCTATCACTGTTACCCCAACAAGTGTAACGACGATGCCCTGGCCTCTAAGGGAGCTCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTCGGGTACATCGCCTGCACACACCTGCATGCCCCGCAAGAGGACAGCGCCATCCGGTGTGGGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCGTCCAGCGCAGCCAACCCCGAGGAGCTGGTGGCATTTGACGTCGTCTGTGGAGATTTCAACTTTGATAACTGCTCCTCTGACGACAAGCTGGAGCAGCAACACTCCCTGTTCACCCACTACAGGGACCCCTGCCGCCTGGGGCCTGGTGAGGAGAAGCCGTGGGCCATCGGTACTCTGCTGGACACGAACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SMPD3(55512)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kyle I Mentkowski et al.
American journal of physiology. Heart and circulatory physiology, 318(6), H1447-H1460 (2020-04-25)
Macrophages play a pivotal role in tissue repair following myocardial infarction (MI). In response to injury, they exist along a spectrum of activation states tightly regulated by their microenvironment. Cardiosphere-derived cells (CDCs) have been shown to mediate cardioprotection via modulation
James Lawson et al.
Oncotarget, 8(48), 83913-83924 (2017-11-16)
Extracellular vesicles (EVs) are key signaling mediators between cancer cells and their supporting stroma, and regulate critical processes such as invasion, metastases, and angiogenesis. We have identified a subset of miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, miR-605-5p) that
Ji Na Kong et al.
International journal of cancer, 137(7), 1610-1620 (2015-04-03)
Many breast cancer cells acquire multidrug resistance (MDR) mediated by ABC transporters such as breast cancer resistance protein (BCRP/ABCG2). Here we show that incubation of human breast cancer MDA-MB-231 cells with farnesoid X receptor antagonist guggulsterone (gug) and retinoid X
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU024631-50UG | 04061831371291 |
| EHU024631-20UG | 04061831349870 |