Skip to Content
Merck
CN

EHU025001

MISSION® esiRNA

targeting human CMKLR1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACTTATCCCCCTTGGAAGCCAGGGTGACCAGGATCTTCCTGGTGGTGGTCTACAGCATCGTCTGCTTCCTCGGGATTCTGGGCAATGGTCTGGTGATCATCATTGCCACCTTCAAGATGAAGAAGACAGTGAACATGGTCTGGTTCCTCAACCTGGCAGTGGCAGATTTCCTGTTCAACGTCTTCCTCCCAATCCATATCACCTATGCCGCCATGGACTACCACTGGGTTTTCGGGACAGCCATGTGCAAGATCAGCAACTTCCTTCTCATCCACAACATGTTCACCAGCGTCTTCCTGCTGACCATCATCAGCTCTGACCGCTGCATCTCTGTGCTCCTCCCTGTCTGGTCCCAGAACCACCGCAGCGTTCGCCTGGCTTACATGGCCTGCATGGTCATCTGGGTCCTGGCTTTCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yixin Zhang et al.
Brain, behavior, and immunity, 70, 179-193 (2018-03-03)
Chemerin, an adipokine, has been reported to reduce the production of pro-inflammatory cytokines and neutrophil infiltration. This study investigated the role of Chemerin and its natural receptor, ChemR23, as well as its downstream mediator calmodulin-dependent protein kinase kinase 2 (CAMKK2)/adenosine
Yuan Wang et al.
Journal of cellular biochemistry, 120(4), 6459-6470 (2018-11-15)
Psoriasis is a chronic disease which carries the emotional and social burden, promotes joint disability and raises comorbidity possibility in patients. Obesity is closely correlated with the occurrence of psoriasis and adipokines produced by adipose tissues were found to be
Yixin Zhang et al.
Cell death & disease, 10(2), 97-97 (2019-02-06)
Hypoxic-ischemic encephalopathy (HIE) is a devastating neurological event that contributes to the prolonged neurodevelopmental consequences in infants. Therapeutic strategies focused on attenuating neuronal apoptosis in the penumbra appears to be promising. Given the increasingly recognized neuroprotective roles of adipokines in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service