Merck
CN
All Photos(1)

Documents

Safety Information

EHU025821

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1B

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGTAAACAGCTCG

Ensembl | human accession no.

ENSG00000111276

NCBI accession no.

NM_004064

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDKN1B(1027) , CDKN1B(1027)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Ying Sun et al.
Oncology letters, 8(4), 1435-1440 (2014-09-10)
Radiotherapy (RT) is a major modality of hepatoma treatment. However, liver tumors often acquire radioresistance, which contributes to RT failure. The exact mechanisms of the radioresistance in hepatoma cells are largely unknown. Glutathione S-transferase M3 (GSTM3) is a phase II
Huimin Wang et al.
Oncology research, 25(9), 1431-1440 (2017-01-22)
Nasopharyngeal carcinoma (NPC) is a common malignancy of the head and neck that arises from the nasopharynx epithelium and is highly invasive. Cyclin-dependent kinase inhibitor 3 (CDKN3) belongs to the dual-specificity protein phosphatase family, which plays a key role in
Takayuki Satoh et al.
Scientific reports, 6, 27829-27829 (2016-06-11)
Potent anti-cancer compounds FR901464 and its methyl-ketal derivative spliceostatin A (SSA) inhibit cell cycle progression at G1 and G2/M phases. These compounds bind to the spliceosome and inhibit the splicing reaction. However, the molecular mechanism underlying G1 arrest after SSA
Ela Alcántara-Flores et al.
Molecules (Basel, Switzerland), 20(12), 21125-21137 (2015-12-04)
Argentatin B has been shown to inhibit the growth of colon HCT-15, and prostate PC-3 cancer cells. However, the mechanism by which argentatin B inhibits cell proliferation is still unknown. We aimed to investigate the mechanism by which argentatin B
Alessandra Verdina et al.
Journal of translational medicine, 6, 27-27 (2008-05-24)
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service