Skip to Content
Merck
CN

EHU026681

MISSION® esiRNA

targeting human TSPAN8

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCCAGAGCATATTGCAGGACAAGCCTGTAACGAATAGTTAAATTCACGGCATCTGGATTCCTAATCCTTTTCCGAAATGGCAGGTGTGAGTGCCTGTATAAAATATTCTATGTTTACCTTCAACTTCTTGTTCTGGCTATGTGGTATCTTGATCCTAGCATTAGCAATATGGGTACGAGTAAGCAATGACTCTCAAGCAATTTTTGGTTCTGAAGATGTAGGCTCTAGCTCCTACGTTGCTGTGGACATATTGATTGCTGTAGGTGCCATCATCATGATTCTGGGCTTCCTGGGATGCTGCGGTGCTATAAAAGAAAGTCGCTGCATGCTTCTGTTGTTTTTCATAGGCTTGCTTCTGATCCTGCTCCTGCAGGTGGCGACAGGTATCCTAGGAGCTGTTTTCAAATCTAAGTCTGATCGCATTGTGAATGAAACTCTCTATGAAAACACAAAGCTTTTGAGCGCCACAGGGGAAAGTGAAAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Manale El Kharbili et al.
Oncotarget, 8(10), 17140-17155 (2017-02-12)
Melanoma is well known for its propensity for lethal metastasis and resistance to most current therapies. Tumor progression and drug resistance depend to a large extent on the interplay between tumor cells and the surrounding matrix. We previously identified Tetraspanin
Manale El Kharbili et al.
Oncogene, 38(20), 3781-3793 (2019-01-27)
Due to its high proclivity to metastasize, and despite the recent development of targeted and immune therapy strategies, melanoma is still the deadliest form of skin cancer. Therefore, understanding the molecular mechanisms underlying melanoma invasion remains crucial. We previously characterized
Lunshou Wei et al.
International journal of clinical and experimental medicine, 8(6), 8599-8607 (2015-08-27)
This study was designed to investigate the effects of Tetraspanin 8 (TSPAN8) overexpression and TSPAN8 suppression on gastric cancer cell proliferation and invasion. Furthermore, whether extracellular-signal regulated kinase (ERK) mitogen-activated protein kinase (MAPK) pathway was involved in TSPAN8's function on

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service