Skip to Content
Merck
CN

EHU027141

MISSION® esiRNA

targeting human PTN

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGTGCAAGCAAACCATGAAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAATACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGAAGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCCTGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGCAAGAAACAGGAGAAGATGCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTTAACTATTGCATTTATATGTACCGTAGGCTTTGTATTCAAAAATTATCTATAGCTAAGTACACAATAAGCAAAAACAAAAAGAAAAGAAAATTTTTGTAGTAGCGTTTTTTAAATGTATACTATAGTACCAGTAGGGGCTTATAATAAAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Biqiang Zhu et al.
Cancer medicine, 9(2), 783-796 (2020-01-21)
Cholangiocarcinoma is a malignant tumor originating from bile duct epithelium. Currently, the treatment strategy is very limited and the prognosis is poor. Recent studies reported celastrol exhibits antigrowth and antimetastasis properties in many tumors. Our study aimed to assess the
Xingxing Sun et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 128, 110201-110201 (2020-05-28)
Opa-interacting protein 5 antisense RNA1 (OIP5-AS1) has been demonstrated to facilitate proliferation, metastasis and resistance to treatments in various types of cancers. Nevertheless, the exact mechanisms underlying the roles of OIP5-AS1 in osteosarcoma(OS) drug resistance have not yet been clearly
Xue Ding et al.
Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie, 255(5), 873-884 (2017-01-14)
The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service