Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAACTTCGGGCACTACCTGGAACACTGGCTGAGCATGGAAGGGCGCAAGGGGGCCCAGCTGCCCCGTATCTTCCATGTCAACTGGTTCCGGCGTGACGAGGCAGGGCACTTCCTGTGGCCAGGCTTTGGGGAGAATGCTCGGGTGCTAGACTGGATCTGCCGGCGGTTAGAGGGGGAGGACAGTGCCCGAGAGACACCCATTGGGCTGGTGCCAAAGGAAGGAGCCTTGGATCTCAGCGGCCTCAGAGCTATAGACACCACTCAGCTGTTCTCCCTCCCCAAGGACTTCTGGGAACAGGAGGTTCGTGACATTCGGAGCTACCTGACAGAGCAGGTCAACCAGGATCTGCCCAAAGAGGTGTTGGCTGAGCTTGAGGCCCTGGAGAGACGTGTGCACAAAATGTGACCTGAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PCK2(5106)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Elisabeth Smolle et al.
Molecular oncology, 14(11), 2853-2867 (2020-08-11)
Inhibition of glycolysis has been considered as a therapeutic approach in aggressive cancers including lung cancer. Abbreviated gluconeogenesis, mediated by phosphoenolpyruvate carboxykinase (PEPCK), was recently discovered to partially circumvent the need for glycolysis in lung cancer cells. However, the interplay
Jiangsha Zhao et al.
Oncotarget, 8(48), 83602-83618 (2017-11-16)
Tumor-initiating cells (TICs) play important roles in tumor progression and metastasis. Identifying the factors regulating TICs may open new avenues in cancer therapy. Here, we show that TIC-enriched prostate cancer cell clones use more glucose and secrete more lactate than
S Luo et al.
Oncogene, 36(25), 3609-3617 (2017-02-07)
For cancer cells to proliferate, a balance must be built between biomass-forming, glucose-metabolized intermediates and ATP production. How intrinsic glucose carbon flow regulates this balance remains unclear. Here we show that mitochondrial phosphoenolpyruvate carboxykinase (PCK2), the hub molecule linking tricarboxylic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU028511-50UG | 04061828342341 |
| EHU028511-20UG | 04061831350357 |