Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGAGGCAGGACCCACCTGGTGGCCTCTGCCCCGTCTCATGAGGGGCCCGAGCAGAAGCAGGATAGTTGCTCCGCCTCTGCTGGCACATTTCCCCAGACCTGAGCTCCCCACCACCCCAGCTGCTCCCCTCCCTCCTCTGTCCCTAGGTCAGCTTGCTGCCCTAGGCTCCGTCAGTATCAGGCCTGCCAGACGGCACCCACCCAGCACCCAGCAACTCCAACTAACAAGAAACTCACCCCCAAGGGGCAGTCTGGAGGGGCATGGCCAGCAGCTTGCGTTAGAATGAGGAGGAAGGAGAGAAGGGGAGGAGGGCGGGGGGCACCTACTACATCGCCCTCCACATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GFAP(2670)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jong-Hyun Moon et al.
Journal of veterinary science, 16(2), 203-211 (2014-10-02)
In the present study, the use of dogs with experimental autoimmune encephalomyelitis (EAE) as a disease model for necrotizing encephalitis (NE) was assessed. Twelve healthy dogs were included in this study. Canine forebrain tissues (8 g), including white and grey
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Amy Treadwell et al.
Veterinary ophthalmology, 18(5), 371-380 (2014-09-02)
To characterize the clinical, diagnostic, and histopathologic findings in dogs with canine ocular gliovascular syndrome (COGS). The archives at the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW) were used to identify eyes with COGS. Histopathological inclusion criteria included: a neovascular
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU029271-50UG | 04061828343034 |
| EHU029271-20UG | 04061828578269 |