Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGCTCTGGAGAGCCAAGATACAGAGAATGTCCCAGTTACACTATCAGAGGAGAACCGTTCTGAAGGAAAAGTTGGTTTTCAGGCCTATAAGAATTACTTCAGAGCTGGTGCTCACTGGATTGTCTTCATTTTCCTTATTCTCCTAAACACTGCAGCTCAGGTTGCCTATGTGCTTCAAGATTGGTGGCTTTCATACTGGGCAAACAAACAAAGTATGCTAAATGTCACTGTAAATGGAGGAGGAAATGTAACCGAGAAGCTAGATCTTAACTGGTACTTAGGAATTTATTCAGGTTTAACTGTAGCTACCGTTCTTTTTGGCATAGCAAGATCTCTATTGGTATTCTACGTCCTTGTTAACTCTTCACAAACTTTGCACAACAAAATGTTTGAGTCAATTCTGAAAGCTCCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ABCC4(10257)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Alejandro Carozzo et al.
Molecular pharmacology, 96(1), 13-25 (2019-05-03)
Pancreatic cancer is one of the most lethal types of tumors with no effective therapy available; is currently the third leading cause of cancer in developed countries; and is predicted to become the second deadliest cancer in the United States
Xue Zhu et al.
Acta biochimica et biophysica Sinica, 50(9), 914-920 (2018-07-31)
Carboplatin is the most commonly used drug in the first-line treatment of human retinoblastoma (RB), but its clinical application is greatly limited due to acquired drug resistance upon the long-term treatment. Forkhead box protein M1 (FoxM1) is the transcription factor
Nobuaki Tanaka et al.
Prostaglandins, leukotrienes, and essential fatty acids, 159, 102139-102139 (2020-06-17)
ATP-binding cassette transporter C4 (ABCC4) is associated with multidrug resistance and the regulation of cell signalling. Some prostaglandins (PGs), including: PGE2, PGF2α, PGE3, and PGF3α are known substrates of ABCC4, and are released from some types of cells to exert
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU030621-50UG | 04061828344345 |
| EHU030621-20UG | 04061828579372 |