Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ACE2(59272)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yingchuan Li et al.
Scientific reports, 5, 8209-8209 (2015-02-04)
ACE2 and Ang-(1-7) have important roles in preventing acute lung injury. However, it is not clear whether upregulation of the ACE2/Ang-(1-7)/Mas axis prevents LPS-induced injury in pulmonary microvascular endothelial cells (PMVECs) by inhibiting the MAPKs/NF-κB pathways. Primary cultured rat PMVECs
Miki Yamaguchi et al.
Biochemical and biophysical research communications, 487(3), 613-618 (2017-04-24)
EGFR-mutant lung adenocarcinomas contain a subpopulation of cells that have undergone epithelial-to-mesenchymal transition and can grow independently of EGFR. To kill these cancer cells, we need a novel therapeutic approach other than EGFR inhibitors. If a molecule is specifically expressed
Xi Cao et al.
Diabetes/metabolism research and reviews, 35(4), e3123-e3123 (2019-01-04)
Previous works indicated that the stress on the endoplasmic reticulum (ER) affected nonalcoholic fatty liver disease (NAFLD). However, there is no clear evident on the effect of the regulation of ER stress by angiotensin-converting enzyme 2 (ACE2) on the prevention
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU033081-50UG | 04061828308736 |
| EHU033081-20UG | 04061828544189 |