Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATACAGACCCACAGAGTGCCATCCCTGAGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TYROBP(7305)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Teng Jiang et al.
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 39(13), 2949-2962 (2014-07-23)
Triggering receptor expressed on myeloid cells 2 (TREM2) gene is a recently identified susceptibility gene for Alzheimer's disease (AD), as its low-frequency variants increase the risk of this disease with an odds ratio similar to that of an APOE ɛ4
Tania N Crotti et al.
Arthritis research & therapy, 14(6), R245-R245 (2012-11-14)
The immunoreceptor tyrosine-based activation motif (ITAM) pathway provides osteoclast co-stimulatory signals and regulates proliferation, survival and differentiation of effector immune cells. In the osteoclast, the receptors Triggering Receptor Expressed on Myeloid cells 2 (TREM2) and Osteoclast Associated Receptor (OSCAR) and
Kevin Carrasco et al.
Cellular & molecular immunology, 16(5), 460-472 (2018-03-24)
The triggering receptor expressed on myeloid cells-1 (TREM-1) is a receptor expressed on innate immune cells. By promoting the amplification of inflammatory signals that are initially triggered by Toll-like receptors (TLRs), TREM-1 has been characterized as a major player in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU033221-50UG | 04061828308873 |
| EHU033221-20UG | 04061831340877 |