Skip to Content
Merck
CN

EHU034001

Sigma-Aldrich

MISSION® esiRNA

targeting human CNN1

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGTTCTCAGCGTCAGTGCCGCCACTGCCCCCGCCAGAGCCCACCGGCCAGCATGTCCTCTGCTCACTTCAACCGAGGCCCTGCCTACGGGCTGTCAGCCGAGGTTAAGAACAAGCTGGCCCAGAAGTATGACCACCAGCGGGAGCAGGAGCTGAGAGAGTGGATCGAGGGGGTGACAGGCCGTCGCATCGGCAACAACTTCATGGACGGCCTCAAAGATGGCATCATTCTTTGCGAATTCATCAATAAGCTGCAGCCAGGCTCCGTGAAGAAGATCAATGAGTCAACCCAAAATTGGCACCAGCTGGAGAACATCGGCAACTTCATCAAGGCCATCACCAAGTATGGGGTGAAGCCCCACGACATTTTTGAGGCCAACGACCTGTTTGAGAACACCAACCATACACAGGTGCAGTCCACCCTCCTGGCTTTGGCCAGCATGGCGAAGACGAAAGGAAACAAGGTGAACGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zheng Wang et al.
Aging, 12(2), 1867-1887 (2020-01-28)
Breast cancer has been the second most prevalent and fatal malignancy due to its frequent metastasis to other organs. We aim to study the effects of a key miRNA-mRNA signaling in breast cancer. CNN1 was identified as the key gene
Kai-Hung Wang et al.
Oncotarget, 8(37), 61133-61145 (2017-10-06)
Increasing evidence indicates that ovarian high-grade serous carcinoma (HGSC) originates from the fallopian tube epithelium and metastasizes to the ovary as the secondary site. A working hypothesis is that detached tubal HGSC cells survive anoikis and implant on the ovary.
Janhavi Moharil et al.
PloS one, 10(10), e0141365-e0141365 (2015-10-28)
Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service