Skip to Content
Merck
CN

EHU034191

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A9

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTGGAACGCAACATAGAGACCATCATCAACACCTTCCACCAATACTCTGTGAAGCTGGGGCACCCAGACACCCTGAACCAGGGGGAATTCAAAGAGCTGGTGCGAAAAGATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACATCATGGAGGACCTGGACACAAATGCAGACAAGCAGCTGAGCTTCGAGGAGTTCATCATGCTGATGGCGAGGCTAACCTGGGCCTCCCACGAGAAGATGCACGAGGGTGACGAGGGCCCTGGCCACCACCATAAGCCAGGCCTCGGGGAGGGCACCCCCTAAGACCACAGTGGCCAAGATCACAGTGGCCACGGCCACGGCCACAGTCATGGTGGCCACGGCCACAGCCACTAATCAGGAGGCCAGGCCACCCTGCCTCTACCCAACCAGGGCCCCGGGGCCTGTTATGTCAAACTGTCTTGGCTGTGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liang Peng et al.
Frontiers in cellular and infection microbiology, 10, 47-47 (2020-03-03)
Bacterial infection remains one of the leading causes of death worldwide due to the continuous rise of multiple antibiotic-resistant bacteria. Focusing solely on bacteria as the drug targets is a major limitation inherent in the conventional antibiotic therapy. Recently, host-directed
Yiwen Zhou et al.
Frontiers in pharmacology, 12, 640521-640521 (2021-04-02)
Hepatic macrophages play a critical role in inflammation caused by alcohol feeding. During this process, variation of macrophage phenotypes triggers inflammatory responses in a variety of ways. Moreover, there is increasing evidence that Brain and Muscle Arnt-Like Protein-1 (Bmal1) is
Ping Wu et al.
Oncology research, 25(9), 1479-1488 (2017-03-10)
Hypopharyngeal cancer (HPC) frequently presents at an advanced stage and displays early submucosal spread, resulting in a poor prognosis. It is among the worst of all cancers in the head and neck subsites. Therefore, detection of HPC at an earlier
Hirokazu Ohata et al.
Cell reports, 28(5), 1282-1295 (2019-08-01)
Cancer stem cells (CSCs) are associated with the refractory nature of cancer, and elucidating the targetable pathways for CSCs is crucial for devising innovative antitumor therapies. We find that the proliferation of CSC-enriched colon spheroids from clinical specimen is dependent
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service