Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FOS(2353)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiang Yin et al.
Journal of atherosclerosis and thrombosis, 24(1), 55-67 (2016-05-31)
Atherosclerosis is a chronic inflammatory disease, which leads to thrombosis and acute coronary syndrome. Matrix metalloproteinase-9 (MMP-9) is involved in the stability of the extracellular matrix (ECM) and atherosclerosis plaque. Until now, it is established that lipopolysaccharide (LPS) and norepinephrine
H Pan et al.
Current molecular medicine, 16(3), 266-275 (2016-02-27)
Endometriosis is a frequent gynecological disease associated with severe pain and infertility. Although its dependency on estrogen is well recognized, the molecular mechanism along the estrogenic pathway has not been fully understood. This study investigates the effect of 17β-estradiol (E2)
Huynh T Hop et al.
Frontiers in cellular and infection microbiology, 8, 287-287 (2018-09-07)
The cellular oncogene c-Fos (c-Fos) is a component of activator protein 1 (AP1), a master transcriptional regulator of cells. The suppression of c-Fos signaling by siRNA treatment resulted in significant induction of TLR4, which subsequently activates p38 and ERK1/2 mitogen-activated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU034291-50UG | 04061828309863 |
| EHU034291-20UG | 04061831341065 |