Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... KLF5(688)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiu-Yu Wang et al.
Molecular oncology, 14(9), 2203-2230 (2020-05-28)
Long noncoding RNAs (lncRNAs) have important regulatory roles in cancer biology. Although some lncRNAs have well-characterized functions, the vast majority of this class of molecules remains functionally uncharacterized. To systematically pinpoint functional lncRNAs, a computational approach was proposed for identification
P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU035131-20UG | 04061831341249 |
| EHU035131-50UG | 04061831362138 |