Skip to Content
Merck
CN

EHU036931

MISSION® esiRNA

targeting human ATG12

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAACCATCCAAGGACTCATTGACTTCATCAAAAAGTTTCTTAAACTTGTGGCCTCAGAACAGTTGTTTATTTATGTGAATCAGTCCTTTGCTCCTTCCCCAGACCAAGAAGTTGGAACTCTCTATGAGTGTTTTGGCAGTGATGGTAAACTGGTTTTACATTACTGCAAGTCTCAGGCGTGGGGATGAACCACAAAGAAAATCAACTTGCTACTACATGAAATGGATTTTCACGGAAGAGACAGCTCTGAAAAGTTTTGATGCTTGTGGCAAGAGACTTAACAGATGTGATCTATTTAGTATGTGTCTACTCTATGTTTATGCATAAGAAAACATCCATAGCATGAATGGACTCAGAAAAATGTGATTTGTATTAATGCACCAGTCATCATAAAAGATGGTCATGATAGTACACCCATTGCTCCTACTTGTTACTATTATTGCTGCAGATCTGCCTCCAAGGTTGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yingqiang Liu et al.
Cell death & disease, 11(3), 175-175 (2020-03-08)
Colorectal cancer (CRC) is a global healthcare problem. Radioresistance is a huge setback for CRC radiotherapy. In this text, the roles and molecular mechanisms of long non-coding RNA HOTAIR in CRC tumorigenesis and radioresistance were further investigated. ATG12 mRNA, HOTAIR
Sachiko Matsuzaki et al.
British journal of pharmacology, 175(10), 1637-1653 (2018-02-20)
A high recurrence rate after medical treatment is a major clinical problem for patients with endometriosis. Here, we have evaluated the in vitro effects of combined treatment with MK2206 (an AKT inhibitor) + chloroquine on cell growth and regrowth of endometriotic stromal
Yongqiang Chen et al.
Cancers, 13(5) (2021-04-04)
The epidermal growth factor receptor (EGFR) family member erb-b2 receptor tyrosine kinase 2 (ERBB2) is overexpressed in many types of cancers leading to (radio- and chemotherapy) treatment resistance, whereas the underlying mechanisms are still unclear. Autophagy is known to contribute
Sun-Jung Cho et al.
Autophagy, 11(1), 100-112 (2014-12-09)
Autophagy is one of the main mechanisms in the pathophysiology of neurodegenerative disease. The accumulation of autophagic vacuoles (AVs) in affected neurons is responsible for amyloid-β (Aβ) production. Previously, we reported that SUMO1 (small ubiquitin-like modifier 1) increases Aβ levels.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service