Skip to Content
Merck
CN

EHU038131

MISSION® esiRNA

targeting human FGF9

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FGF9

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCAGGAAAGACCACAGCCGATTTGGCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTTTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGACAAAGACAGTTTCTTCACTTGAGCCCTTAAAAAAGTAACCACTATAAAGGTTTCACGCGGTGGGTTCTTATTGATTCGCTGTGTCATCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhijin Zhang et al.
Experimental and therapeutic medicine, 19(3), 1711-1718 (2020-02-28)
Development of cisplatin resistance in colorectal cancer is largely caused by dysregulation of signaling pathways, including the Wnt/β-catenin signaling pathway, in cancer cells. Further investigation into the molecular mechanism of chemoresistance could improve outcomes for patients with colorectal cancer. The
Wei Wang et al.
Oncology letters, 19(1), 1001-1007 (2020-01-04)
Breast cancer has become an important public health problem. Moreover, the functions of microRNA-431 (miR-431) have been detected in human cancers other than breast cancer. Hence, we investigated the role of miR-431 in progression of breast cancer. RT-qPCR and Western
Longhao Li et al.
Biology open, 9(5) (2020-05-06)
Tumor metastasis is the main contributor to high recurrence and mortality in colorectal cancer (CRC). In a previous study, we found that DJ-1 plays an important role in CRC metastasis, and is the main target in Ciclopirox olamine (CPX)-treated CRC.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service