Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCACCACAGAAGACAATCAATCATCAGGGCCTCCCACTGGCACCGCTTTATTGGAGACCAGCACCCTAAACAGCACAGGTCCCAGCAATCCTTGCCAAGATGATCCCTGTGCAGATAATTCGTTATGTGTTAAGCTGCATAATACAAGTTTTTGCCTGTGTTTAGAAGGGTATTACTACAACTCTTCTACATGTAAGAAAGGAAAGGTATTCCCTGGGAAGATTTCAGTGACAGTATCAGAAACATTTGACCCAGAAGAGAAACATTCCATGGCCTATCAAGACTTGCATAGTGAAATTACTAGCTTGTTTAAAGATGTATTTGGCACATCTGTTTATGGACAGACTGTAATTCTTACTGTAAGCACATCTCTGTCACCAAGATCTGAAATGCGTGCTGATGACAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MUC13(56667)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hui Wang et al.
Journal of cancer research and therapeutics, 11 Suppl 1, C74-C79 (2015-09-02)
Mucin 13 (MUC13) and Mucin 20 (MUC20) are high molecular weight transmembrane O-linked glycoprotein secreted by epithelium and are widely overexpressed in epithelial tumor cells. Previously, it has been reported that MUC13 and MUC20 were prognostic molecular biomarkers of some
Andrew E Massey et al.
Micron (Oxford, England : 1993), 130, 102822-102822 (2020-01-14)
Pancreatic cancer is one of the most lethal cancers in the United States. This is partly due to the difficulty in early detection of this disease as well as poor therapeutic responses to currently available regimens. Our previous reports suggest
Sheema Khan et al.
Oncotarget, 5(17), 7599-7609 (2014-10-04)
Pancreatic cancer has a poor prognosis due to late diagnosis and ineffective therapeutic multimodality. MUC13, a transmembrane mucin is highly involved in pancreatic cancer progression. Thus, understanding its regulatory molecular mechanisms may offer new avenue of therapy for prevention/treatment of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU038491-50UG | 04061828313648 |
| EHU038491-20UG | 04061828548781 |