Skip to Content
Merck
CN

EHU038881

MISSION® esiRNA

targeting human SERPINF1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Medi Eslani et al.
Stem cells (Dayton, Ohio), 36(5), 775-784 (2018-01-18)
Macrophages are crucial drivers of inflammatory corneal neovascularization and thus are potential targets for immunomodulatory therapies. We hypothesized that therapeutic use of cornea-derived mesenchymal stromal cells (cMSCs) may alter the function of macrophages. We found that cMSCs can modulate the
Hua Jiang et al.
Urologic oncology, 37(2), 150-157 (2018-11-21)
MicroRNA-93 (miR-93) is upregulated in the urine of patients with bladder cancer (BC). Here, we investigated the role of miR-93 in BC progression and explored the underlying mechanism. miR-93 expression in BC tissues and cells was detected by real time-polymerase
Ting Zhang et al.
Cell death & disease, 8(6), e2838-e2838 (2017-06-02)
Distant metastasis is the primary cause of nasopharyngeal carcinoma (NPC) treatment failure while epithelial-mesenchymal transition (EMT) is the critical process of NPC invasion and metastasis. However, tumor-suppressor genes involved in the EMT and metastasis of NPC have not been explored
Jan Darius Unterlauft et al.
Experimental eye research, 127, 206-214 (2014-08-17)
The death of retinal ganglion cells (RGC) leads to visual impairment and blindness in ocular neurodegenerative diseases, primarily in glaucoma and diabetic retinopathy; hence, mechanisms that contribute to protecting RGC from ischemia/hypoxia are of great interest. We here address the
Jie Liu et al.
Journal of cardiovascular pharmacology, 63(6), 553-561 (2014-04-09)
To investigate the protective effects of D-4F, an apolipoprotein A-I mimetic peptide, on oxidized low-density lipoprotein (ox-LDL)-induced injury of vascular endothelial cells and the potential role of pigment epithelium-derived factor (PEDF). Cytotoxicity was assessed by the apoptotic rate, 3-(4,5-dimethylthiazol-2-y-l)-2,5-diphenyl-2H-tetrazolium bromide

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service