Skip to Content
Merck
CN

EHU039341

MISSION® esiRNA

targeting human TRPC5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACCTGGCCAAGTTGAAGGTGGCAATCAAATACCACCAGAAAGAGTTTGTTGCTCAGCCCAACTGCCAACAGTTGCTTGCCACCCTGTGGTATGATGGCTTCCCTGGATGGCGGCGGAAACACTGGGTAGTCAAGCTTCTAACCTGCATGACCATTGGGTTCCTGTTTCCCATGCTGTCTATAGCCTACCTGATCTCACCCAGGAGCAACCTTGGGCTGTTCATCAAGAAACCCTTTATCAAGTTTATCTGCCACACAGCATCCTATTTGACCTTCCTCTTTATGCTTCTCCTGGCTTCTCAGCACATTGTCAGGACAGACCTTCATGTACAGGGGCCTCCCCCAACTGTCGTGGAATGGATGATATTGCCTTGGGTTCTAGGTTTCATTTGGGGTGAGATTAAGGAAATGTGGGATGGTGGATTTACTGAATACATCCATGACTGGTGGAACCTGATGGATTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Yan Zou et al.
Oncology reports, 41(6), 3413-3423 (2019-04-04)
Temozolomide (TMZ) is the first choice chemotherapy agent against glioblastoma, but the TMZ chemotherapy resistance has restricted the clinical application. Although autophagy is considered an adaptive response for cell survival under the pressure of chemotherapy and associated with chemotherapy resistance
Peng Zhang et al.
Scientific reports, 7(1), 3158-3158 (2017-06-11)
Adriamycin is a first-line chemotherapy agent against cancer, but the development of resistance has become a major problem. Although autophagy is considered to be an adaptive survival response in response to chemotherapy and may be associated with chemoresistance, its inducer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service