Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGATGGACACTGCAAAGAGAAGAAATCCGTAAGTCCATCTGCCAGCCCAGTTGTTTGCTATCAGTCCAACCGTGATGAGCTCCGACGTCGCATCATCCAGTGGCTGGAAGCTGAGATCATTCCAGATGGCTGGTTCTCTAAAGGCAGCAACTACAGTGAAATCCTAGACAAGTATTTTAAGAACTTTGATAATGGTGATTCTCGCCTGGACTCCAGTGAATTCCTGAAGTTTGTGGAACAGAATGAAACTGCCATCAATATTACAACGTATCCAGACCAGGAGAACAACAAGTTGCTTAGGGGACTCTGTGTTGATGCTCTCATTGAACTGTCTGATGAAAATGCTGATTGGAAACTCAGCTTCCAAGAGTTTCTCAAGTGCCTCAACCCATCTTTCAACCCTCCTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FSTL1(11167)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wei Zhang et al.
Scientific reports, 7, 45820-45820 (2017-04-01)
Pulmonary hypertension (PH) remains a life-limiting disease characterized by pulmonary vascular remodelling due to aberrant proliferation and migration of pulmonary artery smooth muscle cells (PASMCs), thus leading to raised pulmonary arterial pressure and right ventricular hypertrophy. Secreted glycoprotein follistatin-like 1
Marco Chi-Chung Lau et al.
Cancer research, 77(21), 5886-5899 (2017-09-09)
Esophageal squamous cell carcinoma (ESCC) has a generally poor prognosis, and molecular markers to improve early detection and predict outcomes are greatly needed. Here, we report that the BMP-binding follistatin-like protein FSTL1 is overexpressed in ESCCs, where it correlates with
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU039371-20UG | 04061828534258 |
| EHU039371-50UG | 04061831362367 |