Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PIK3CA(5290)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhao Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2505-2515 (2017-11-14)
Numerous studies have demonstrated that aberrant microRNA (miRNA) expression is involved in human disease including cancer. To date, the potential miRNAs regulating lung cancer growth and progression are not fully identified yet. In this study, the expression of miR-142-5p was
Shuke Ge et al.
Oncology research, 25(8), 1363-1371 (2017-03-02)
miR-152, as a tumor suppressor, has been reported to be downregulated in a number of cancer cell lines and tumor tissues, including breast cancer. This study aimed to investigate the role of miR-152 in human breast cancer and its underlying
Xiuling Liang et al.
Yonsei medical journal, 60(2), 182-190 (2019-01-23)
This study aimed to investigate the effects of PIK3CA on the sensitivity of acute B lymphocytic leukemia cells (Nalm-6 cells) to chemotherapy drugs. Children's normal B lymphocytes and Nalm-6 cells were cultured. Nalm-6 cells were transfected with PIK3CA siRNA (siPIK3CA
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU039391-20UG | 04061831341805 |
| EHU039391-50UG | 04061828299041 |