Skip to Content
Merck
CN

EHU040071

MISSION® esiRNA

targeting human DPYSL3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DPYSL3(1809)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xin Gao et al.
The Prostate, 78(9), 682-690 (2018-03-31)
Metastasis is the major cause of cancer-specific death in patients with prostate cancer (PCa). We previously reported that collapsing response mediator protein-4 (CRMP4) is a PCa metastasis-suppressor gene and the hypermethylation in CRMP4 promoter is responsible for the transcription repression
Hisaharu Oya et al.
Journal of gastroenterology, 50(5), 590-600 (2014-09-01)
Patients with hepatocellular carcinoma (HCC) may relapse after curative resection. Sensitive biomarkers for HCC are required to enhance disease management. Dihydropyrimidinase-like 3 (DPYSL3) suppresses cell proliferation and tumorigenicity of certain malignancies; however, its role in HCC is unknown. The expression
Xiaowei Wei et al.
Molecular therapy. Nucleic acids, 20, 502-517 (2020-04-25)
Neural tube defects (NTDs) result in prenatal mortality and lifelong morbidity, and available treatments have limited efficacy. We previously suggested that prenatal bone marrow-derived mesenchymal stem cell (BMSC) transplantation could treat neuron deficiency in NTD rats; however, BMSC-based therapy is
Ke Li et al.
Oncotarget, 6(12), 10030-10044 (2015-04-19)
Prostate cancer is the most commonly diagnosed non-cutaneous cancer and one of the leading causes of cancer death for North American men. Whereas localized prostate cancer can be cured, there is currently no cure for metastatic prostate cancer. Here we

Global Trade Item Number

SKUGTIN
EHU040071-50UG04061828299683
EHU040071-20UG04061828534852

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service