Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DPYSL3(1809)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xin Gao et al.
The Prostate, 78(9), 682-690 (2018-03-31)
Metastasis is the major cause of cancer-specific death in patients with prostate cancer (PCa). We previously reported that collapsing response mediator protein-4 (CRMP4) is a PCa metastasis-suppressor gene and the hypermethylation in CRMP4 promoter is responsible for the transcription repression
Hisaharu Oya et al.
Journal of gastroenterology, 50(5), 590-600 (2014-09-01)
Patients with hepatocellular carcinoma (HCC) may relapse after curative resection. Sensitive biomarkers for HCC are required to enhance disease management. Dihydropyrimidinase-like 3 (DPYSL3) suppresses cell proliferation and tumorigenicity of certain malignancies; however, its role in HCC is unknown. The expression
Xiaowei Wei et al.
Molecular therapy. Nucleic acids, 20, 502-517 (2020-04-25)
Neural tube defects (NTDs) result in prenatal mortality and lifelong morbidity, and available treatments have limited efficacy. We previously suggested that prenatal bone marrow-derived mesenchymal stem cell (BMSC) transplantation could treat neuron deficiency in NTD rats; however, BMSC-based therapy is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU040071-50UG | 04061828299683 |
| EHU040071-20UG | 04061828534852 |