Skip to Content
Merck
CN

EHU040501

MISSION® esiRNA

targeting human UHRF1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human UHRF1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCCGGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACAGGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGCCAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGCAAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGGTTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCTTCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGGATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGGCCAACCGAGAGCGAGAGAAGGAGAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting-Ting Ge et al.
Journal of ovarian research, 9(1), 42-42 (2016-07-20)
Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells.
Jieying Chen et al.
Journal of cellular and molecular medicine, 22(5), 2856-2864 (2018-03-09)
WD repeat protein 79 (WDR79) is a member of the WD-repeat protein family characterized by the presence of a series of WD-repeat domains and is a scaffold protein that participates in telomerase assembly, Cajal body formation and DNA double strand
Mahmoud Alhosin et al.
Technology in cancer research & treatment, 19, 1533033820947489-1533033820947489 (2020-09-12)
Thymoquinone (TQ), a natural anticancer agent exerts cytotoxic effects on several tumors by targeting multiple pathways, including apoptosis. Difluoromethylornithine (DFMO), an irreversible inhibitor of the ornithine decarboxylase (ODC) enzyme, has shown promising inhibitory activities in many cancers including leukemia by
Daiki Goto et al.
Cancer investigation, 38(4), 240-249 (2020-03-28)
We evaluated the value of UHRF1, a regulator of methylation, as a biomarker for lung cancer. UHRF1 is expressed at higher levels in both lung adenocarcinoma (AD) and squamous cell carcinoma (SQ); however, a meta-analysis showed that UHRF1 expression is
Guangyan Kan et al.
Oncotarget, 8(24), 39497-39511 (2017-05-04)
UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service