Skip to Content
Merck
CN

EHU041301

Sigma-Aldrich

MISSION® esiRNA

targeting human CD9

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTGATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAGGAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAAATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAGTTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTGAAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATCTCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGATGCCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD9(928), CD9(928)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuichiro Miki et al.
British journal of cancer, 118(6), 867-877 (2018-02-14)
This corrects the article DOI: 10.1038/bjc.2017.85.
Jung Hee Cho et al.
Cell death and differentiation, 27(9), 2681-2696 (2020-04-30)
CD9, a 24 kDa tetraspanin membrane protein, is known to regulate cell adhesion and migration, cancer progression and metastasis, immune and allergic responses, and viral infection. CD9 is upregulated in senescent endothelial cells, neointima hyperplasia, and atherosclerotic plaques. However, its role
Joshua S Brzozowski et al.
Scientific reports, 8(1), 8822-8822 (2018-06-13)
To facilitate intercellular communication, cells release nano-sized, extracellular vesicles (EVs) to transfer biological cargo to both local and distant sites. EVs are enriched in tetraspanins, two of which (CD9 and CD151) have altered expression patterns in many solid tumours, including
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Germana Rappa et al.
Oncotarget, 6(10), 7970-7991 (2015-03-13)
Interaction of breast cancer cells (BCCs) with stromal components is critical for tumor growth and metastasis. Here, we assessed the role of CD9 in adhesion, migration and invasiveness of BCCs. We used co-cultures of BCCs and bone marrow-derived multipotent mesenchymal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service