Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGACTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATATACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGAACTCAAAGACACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AQP4(361)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chao Yang et al.
IUBMB life, 67(3), 182-190 (2015-04-11)
Emerging evidence indicates that the water channel protein aquaporin 4 (AQP4) plays an essential role in water homeostasis and is implicated in the pathogenesis of brain edema. This study aimed to understand the physiological role of AQP4 in hypoxia-ischemia-mediated cytotoxic
Letizia Granieri et al.
PloS one, 7(6), e38896-e38896 (2012-06-22)
Neuromyelitis optica (NMO) is a severely disabling autoimmune disorder of the central nervous system, which predominantly affects the optic nerves and spinal cord. In a majority of cases, NMO is associated with antibodies to aquaporin-4 (AQP4) (termed NMO-IgG). In this
Yusi Cheng et al.
Clinical and experimental pharmacology & physiology, 44(11), 1106-1115 (2017-07-09)
Aquaporin 4 (AQP4) is a type of water channel protein that maintains the water balance of cardiomyocytes. However, the physiological role of AQP4 in cardiovascular disease is poorly understood. We wanted to explore whether p66Shc and endoplasmic reticulum stress participates
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU041431-20UG | 04061831342116 |
| EHU041431-50UG | 04061831362497 |