Skip to Content
Merck
CN

EHU041471

MISSION® esiRNA

targeting human EPHA4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human EPHA4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGCAGTGCGAGAGTTTGCCAAAGAAATTGACGCATCCTGCATTAAGATTGAAAAAGTTATAGGAGTTGGTGAATTTGGTGAGGTATGCAGTGGGCGTCTCAAAGTGCCTGGCAAGAGAGAGATCTGTGTGGCTATCAAGACTCTGAAAGCTGGTTATACAGACAAACAGAGGAGAGACTTCCTGAGTGAGGCCAGCATCATGGGACAGTTTGACCATCCGAACATCATTCACTTGGAAGGCGTGGTCACTAAATGTAAACCAGTAATGATCATAACAGAGTACATGGAGAATGGCTCCTTGGATGCATTCCTCAGGAAAAATGATGGCAGATTTACAGTCATTCAGCTGGTGGGCATGCTTCGTGGCATTGGGTCTGGGATGAAGTATTTATCTGATATGAGCTATGTGCATCGTGATCTGGCCGCACGGAACATCCTGGTGAACAGCAACTTGGTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ibrahim Y Hachim et al.
Scientific reports, 7(1), 14976-14976 (2017-11-05)
Breast cancer consists of a range of tumor subtypes with different clinical characteristics, disease prognosis, and treatment-response. Luminal breast cancer has the best prognosis while basal-like breast cancer (BLBC) represents the worst subtype. Transforming growth factor-beta (TGFβ) plays a prominent
Min-Ji Kim et al.
Journal of pain research, 13, 1173-1183 (2020-06-18)
Although the Eph receptor plays an important role in the development of neuropathic pain following nerve injury, there has been no evidence of the participation of the ephrin A4 receptor (EphA4) in the development of trigeminal neuropathic pain. The present
Hui-Xing Wei et al.
Inflammation, 42(2), 572-585 (2018-10-27)
Accumulating evidence indicates that post-injury inflammation characterized by activated microglia contributes much to the neuropathology of ischemic injury. Several studies have demonstrated that microglia exhibit two entirely different functional activation states, referred to as classically activated (M1) and alternatively activated
Kensuke Tamura et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(12), 16383-16396 (2020-10-23)
Several lines of evidence suggest that the aggregation and deposition of amyloid-β peptide (Aβ) initiate the pathology of Alzheimer's disease (AD). Recently, a genome-wide association study demonstrated that a single-nucleotide polymorphism proximal to the EPHA4 gene, which encodes a receptor
Zeqin Zhang et al.
Journal of hypertension, 37(4), 775-789 (2019-03-01)
We investigated the association of genetic variants of EPHA4, a receptor tyrosine kinase, with hypertension, and its role in vascular smooth muscle cell (VSMC) contractility. Data from two human genetic studies, ADVANCE and HCHS/SOL, were analyzed for association of EPHA4

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service