Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAGCCAAGCATTGTTGAAGGGTGATAAGTCTGTCAGAGTTATGCGTTCTTTGCTGGCTGCACAACAGACATTTGTAGATCGGTTGGTGCATCTAATGAAGGCAGTACAACGCGAAAGTGGAAATCGTAAGAAAAAGAATGAGAGACTACAGGCATTGCTTGGAGATAATGAAAAGATGAATTTGTCAGATGTGGAACTTATCCCGTTGCCTTTAGAACCCCAAGTGAAAATTAGAGGAATAATTCCGGAAACAGCTACACTGTTTAAAAGTGCCCTTATGCCTGCACAGTTGTTTTTTAAGACGGAAGATGGAGGCAAATATCCAGTTATATTTAAGCATGGAGATGATTTACGTCAAGATCAACTTATTCTTCAAATCATTTCACTCATGGACAAGCTGTTACGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PIK3C3(5289)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Pierre-Luc Mouchel et al.
Cancers, 12(10) (2020-10-16)
Dendrogenin A (DDA), a mammalian cholesterol metabolite with tumor suppressor properties, has recently been shown to exhibit strong anti-leukemic activity in acute myeloid leukemia (AML) cells by triggering lethal autophagy. Here, we demonstrated that DDA synergistically enhanced the toxicity of
María Cecilia Gimenez et al.
Journal of virology, 95(6) (2020-12-29)
Infectious bursal disease virus (IBDV) is the archetypal member of the family Birnaviridae and the etiological agent of Gumboro disease, a highly contagious immunosuppressive infection of concern to the global poultry sector for its adverse health effects in chicks. Unlike
Jian-Kang Chen et al.
The Journal of clinical investigation, 125(6), 2429-2444 (2015-05-20)
Kidney size adaptively increases as mammals grow and in response to the loss of 1 kidney. It is not clear how kidneys size themselves or if the processes that adapt kidney mass to lean body mass also mediate renal hypertrophy
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU042421-50UG | 04061828301904 |
| EHU042421-20UG | 04061828550005 |