Skip to Content
Merck
CN

EHU043151

Sigma-Aldrich

MISSION® esiRNA

targeting human KPNB1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCATGGACTGTAGGCAGAATTTGTGAGCTGCTTCCTGAAGCTGCCATCAATGATGTCTACTTGGCTCCCCTGCTACAGTGTCTGATTGAGGGTCTCAGTGCTGAACCCAGAGTGGCTTCAAATGTGTGCTGGGCTTTCTCCAGTCTGGCTGAAGCTGCTTATGAAGCTGCAGACGTTGCTGATGATCAGGAAGAACCAGCTACTTACTGCTTATCTTCTTCATTTGAACTCATAGTTCAGAAGCTCCTAGAGACTACAGACAGACCTGATGGACACCAGAACAACCTGAGGAGTTCTGCATATGAATCTCTGATGGAAATTGTGAAAAACAGTGCCAAGGATTGTTATCCTGCTGTCCAGAAAACGACTTTGGTCATCATGGAACGACTGCAACAGGTTCTTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Noboru Sekimoto et al.
Journal of Cancer, 8(19), 4125-4140 (2017-12-01)
Lung cancer is a major cause of death worldwide, with lung adenocarcinoma being the most frequently diagnosed subtype in Japan. Finding the target of an anticancer drug can improve lung adenocarcinoma treatments. Polo-like kinase 1 (PLK1) is an essential mitotic
Michiko Kodama et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(35), E7301-E7310 (2017-08-16)
Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has not been changed significantly during several decades. To seek new therapeutic targets for EOC, we performed an in vivo dropout screen in human tumor xenografts using a pooled
Zhen Wang et al.
Emerging microbes & infections, 9(1), 2030-2045 (2020-09-03)
The interferon-inducible myxovirus resistance B (MxB) protein has been reported to inhibit HIV-1 and herpesviruses by blocking the nuclear import of viral DNA. Here, we report a new antiviral mechanism in which MxB restricts the nuclear import of HIV-1 regulatory
Aihua Dai et al.
Neurochemical research, 40(11), 2177-2187 (2015-08-26)
Kpnb1, also known as Importin β1, is a member of the Karyopherin protein family which plays a important role in nuclear import and export pathways. Its expression has been shown to be responsive to stress, such as heat shock, ethanol

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service