Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAAGGTGATTTCAAAGGAGCAAGTAATGTTTATGTCAGATAGTGTCTTTACAACCAGAAATCTTCTTGAACAGATTGTCCTGCCTTTAAAAAAATTGACTTATATCTACTCAGTTGTATTAACCTTGGTGTCAGAAAAAGTTTATGATTGGAAAGTTTTAGCTGATGTCCTGGGTTACTCACATCTGTCCCTGGAAGATTTTGATCAAATTCAAGCAGACAAAGAATCAGAGAAAGTTTCTTATGTTATAAAGAAGTTAAAGGAAGATTGCCACACAGAGAGAAATACAAGGAAGTTTCTGTATGAACTTATTGTGGCTCTTCTGAAAATGGATTGCCAAGAGTTAGTCGCACGTCTCATCCAAGAAGCTGCTGTTCTGACTTCAGCTGTCAAGCTTGGAAAAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MACC1(346389)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
C J Wei et al.
Neoplasma, 67(3), 537-546 (2020-02-18)
Gastric cardia adenocarcinoma (GCA) is one of the most common types of cancer and the incidence is increasing globally. MicroRNAs (miRNAs) have been reported to play critical roles in the progression of GCA. However, the exact role of miR-638 in
Qiang Zhang et al.
Acta biochimica et biophysica Sinica, 50(8), 748-756 (2018-07-03)
One of the major obstacles hindering the treatment of lung cancer (LC) is chemoresistance; however, its mechanism remains unclear. The overexpression of the metastasis-associated in colon cancer 1 (MACC1) gene has been demonstrated to reverse chemoresistance. In the current study
Mingliang Lu et al.
Experimental and therapeutic medicine, 17(4), 2807-2814 (2019-03-25)
The mortality and incidence rates of colorectal cancer (CRC) vary widely worldwide. miR-338-3p inhibits tumor cell proliferation in several types of cancer, however, the role of miR-338-3p on CRC remains unknown. The aim of the current study was to investigate
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU044751-50UG | 04061828304141 |
| EHU044751-20UG | 04061828550753 |