Skip to Content
Merck
CN

EHU046621

MISSION® esiRNA

targeting human IL6

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human IL6

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... IL6(3569), IL6(3569)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Thi Thuy Tien Vo et al.
Journal of Cancer, 11(20), 6038-6049 (2020-09-15)
Recently, many studies have indicated that ambient air particulate matter (PM) can increase the risk of oral cancer. The most common malignant tumor in the oral cavity is oral squamous cell carcinoma (OSCC). Usually, cancer cell migration/invasion is the most
Eun-Ah Ye et al.
Vision research, 139, 15-22 (2017-04-24)
microRNA (miRNA) play critical roles in the pathological processes of diabetic retinopathy, including inflammatory responses, insulin signaling, and angiogenesis. In addition to their regulatory functions on gene expression, miRNA is considered as a potential therapeutic target, as well as a
Shui-Fang Chen et al.
Molecular medicine reports, 16(3), 2733-2739 (2017-06-29)
Resistance to epidermal growth factor receptor (EGFR) inhibitors is of primary concern in the treatment of non‑small‑cell lung cancer (NSCLC) with EGFR mutations. To investigate the effects of matrine on H1975 cells and to examine a novel, potential treatment option for NSCLC
Xiongyan Wu et al.
Oncotarget, 8(13), 20741-20750 (2017-02-12)
Cancer-associated fibroblasts (CAFs), as the activated fibroblasts in tumor stroma, are important modifiers of tumor progression. However, the molecular mechanisms underlying the tumor-promoting properties of CAFs in gastric cancer remain unclear. Here, we show that CAFs isolated from gastric cancer
HongYu Dong et al.
Journal of cellular biochemistry, 119(8), 6535-6544 (2018-02-02)
RE (Radiation enteritis) has been characterized by the inflammation reaction, and in this study, we aim to explore inflammatory cytokines and underlying mechanism involved in the pathogenesis of RE. Luciferase assay was performed to explore whether polymorphism affected the expression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service