Skip to Content
Merck
CN

EHU046621

Sigma-Aldrich

MISSION® esiRNA

targeting human IL6

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCAATAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCAGGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGGCAAATGTAGCATGGGCACCTCAGATTGTTGTTGTTAATGGGCATTCCTTCTTCTGGTCAGAAACCTGTCCACTGGGCACAGAACTTATGTTGTTCTCTATGGAGAACTAAAAGTATGAGCGTTAGGACACTATTTTAATTATTTTTAATTTATTAATATTTAAATATGTGAAGCTGAGTTAATTTATGTAAGTCATATTTATATTTTTAAGAAGTACCACTTGAAACATTTTATGTATTAGTTTTGAAATAATAATGGAAAGTGGCTATGCAGTTTGAATATCCTTTGTTTCAGAGCCAGATCATTTCTTGG

Ensembl | human accession no.

ENSG00000136244

NCBI accession no.

NM_000600

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IL6(3569), IL6(3569)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
OCV
IGT
CXS
JBS
UVR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

HongYu Dong et al.
Journal of cellular biochemistry, 119(8), 6535-6544 (2018-02-02)
RE (Radiation enteritis) has been characterized by the inflammation reaction, and in this study, we aim to explore inflammatory cytokines and underlying mechanism involved in the pathogenesis of RE. Luciferase assay was performed to explore whether polymorphism affected the expression
Xiongyan Wu et al.
Oncotarget, 8(13), 20741-20750 (2017-02-12)
Cancer-associated fibroblasts (CAFs), as the activated fibroblasts in tumor stroma, are important modifiers of tumor progression. However, the molecular mechanisms underlying the tumor-promoting properties of CAFs in gastric cancer remain unclear. Here, we show that CAFs isolated from gastric cancer
Qiang Fu et al.
Cancer cell international, 17, 79-79 (2017-09-08)
Cisplatin has been used in the treatment of many cancers, including laryngeal cancer; however, its efficacy can be reduced due to the development of drug resistance. This study aimed to investigate whether interleukin-6 (IL-6) knockdown may enhance the efficacy of
Hu Liu et al.
Biochemical and biophysical research communications, 486(2), 239-244 (2017-03-04)
Limited efficacy of immune checkpoint inhibitors in hepatocellular carcinoma (HCC) was observed in clinical trials, thus prompting investigation into combination therapy. Interleukin-6 (IL-6) has important roles in modeling immune responses in cancers. Here, we hypothesized that IL-6 blockade would enhance
Yaqi Yin et al.
Cell death & disease, 9(7), 760-760 (2018-07-11)
Progressive pancreatic β-cell dysfunction is recognized as a fundamental pathology of type 2 diabetes (T2D). Recently, mesenchymal stem cells (MSCs) have been identified in protection of islets function in T2D individuals. However, the underlying mechanisms remain elusive. It is widely
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service