Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TFAM(7019)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hiroya Yamada et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(10), 11431-11442 (2019-07-18)
Fructose consumption is rising globally, but maternal high fructose intake might adversely affect offspring. Our previous report demonstrated that excess maternal fructose intake impairs hippocampal function in offspring, indicating that the hippocampi of offspring are highly sensitive to maternal fructose.
Hao Ni et al.
Cancer biology & medicine, 18(1), 139-154 (2021-02-26)
Vascular endothelial growth factor (VEGF), apart from its predominant roles in angiogenesis, can enhance cancer cell proliferation, but its mechanisms remain elusive. The purpose of the present study was therefore to identify how VEGF regulates cancer cell proliferation. VEGF effects
Xu Jiang et al.
Cancers, 12(2) (2020-02-26)
Mitochondrial transcription factor A (TFAM) is required for mitochondrial DNA replication and transcription, which are essential for mitochondrial biogenesis. Previous studies reported that depleting mitochondrial functions by genetic deletion of TFAM impaired autophagic activities. However, the underlying mechanisms remain largely
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU047401-20UG | 04061831342956 |
| EHU047401-50UG | 04061831371765 |