Skip to Content
Merck
CN

EHU047441

MISSION® esiRNA

targeting human NQO1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NQO1(1728)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Masahiro Sekiguchi et al.
NPJ precision oncology, 4, 20-20 (2020-07-14)
Although hepatoblastoma is the most common pediatric liver cancer, its genetic heterogeneity and therapeutic targets are not well elucidated. Therefore, we conducted a multiomics analysis, including mutatome, DNA methylome, and transcriptome analyses, of 59 hepatoblastoma samples. Based on DNA methylation
Peter Tsvetkov et al.
Frontiers in pharmacology, 12, 671929-671929 (2021-07-09)
Silent information regulator 2-related enzyme 1 (SIRT1) is an NAD+-dependent class III deacetylase and a key component of the cellular metabolic sensing pathway. The requirement of NAD+ for SIRT1 activity led us to assume that NQO1, an NADH oxidoreductase producing
Brian Madajewski et al.
Molecular cancer research : MCR, 14(1), 14-25 (2015-11-11)
The fundamental role that NAD(P)H/quinone oxidoreductase 1 (NQO1) plays, in normal cells, as a cytoprotective enzyme guarding against stress induced by reactive oxygen species (ROS) is well documented. However, what is not known is whether the observed overexpression of NQO1
Xiang-Zhai Zhao et al.
OncoTargets and therapy, 11, 3609-3617 (2018-06-29)
Spindlactone A (SPL-A) is a novel small molecule inhibitor of TACC3 that selectively inhibits the nucleation of centrosome microtubules and induces mitotic arrest in ovarian cancer cells. SPL-A is derived from dicoumarol which inhibits the activity of NAD(P)H dehydrogenase quinone
Siriwoot Butsri et al.
Oncology letters, 13(6), 4540-4548 (2017-06-11)
We previously reported that upregulation of NAD(P)H:quinone oxidoreductase 1 (NQO1) in cholangiocarcinoma (CCA; a fatal bile duct cancer) was associated with poor prognosis. It was also demonstrated that the suppression of NQO1 was able to enhance the chemosensitivity of CCA

Global Trade Item Number

SKUGTIN
EHU047441-50UG04061828320752
EHU047441-20UG04061828556052

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service