Skip to Content
Merck
CN

EHU047541

MISSION® esiRNA

targeting human CDK5R1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCGGTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATTTTTAAGAATTTATTATTAAATCAGTTTTGTGTACAGTATGTGTCTAGCAAAGCCACCAAGGGCCTCACCTTTCCCACAGTCTCTCCCTGGGGTTTTTTTCATCCCTGCCAAGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tianmei Qian et al.
Molecular and cellular biochemistry, 447(1-2), 209-215 (2018-02-02)
The proliferation and migration of Schwann cells are critical for the repair and regeneration of injured peripheral nerves. Noncoding RNAs, especially microRNAs (miRNAs), have been demonstrated to participate in regulating the biological behaviors of Schwann cells. Numerous differentially expressed novel
Silvia Moncini et al.
PloS one, 6(5), e20038-e20038 (2011-06-01)
CDK5R1 encodes p35, a specific activator of the serine/threonine kinase CDK5, which plays crucial roles in CNS development and maintenance. CDK5 activity strongly depends on p35 levels and p35/CDK5 misregulation is deleterious for correct CNS function, suggesting that a tightly

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service