Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCCTAATTCTTCCTCCAGCGATGTACGCACTGTCAGTTACACCAATCTGAAGTTTATGGCTACCCAAATTGCCTCTGGCATGAAGTACCTTTCCTCTCTTAATTTTGTTCACCGAGATCTGGCCACACGAAACTGTTTAGTGGGTAAGAACTACACAATCAAGATAGCTGACTTTGGAATGAGCAGGAACCTGTACAGTGGTGACTATTACCGGATCCAGGGCCGGGCAGTGCTCCCTATCCGCTGGATGTCTTGGGAGAGTATCTTGCTGGGCAAGTTCACTACAGCAAGTGATGTGTGGGCCTTTGGGGTTACTTTGTGGGAGACTTTCACCTTTTGTCAAGAACAGCCCTATTCCCAGCTGTCAGATGAACAGGTTATTGAGAATACTGGAGAGTTCTTCCGAGACCAAGGGAGGCAGACTTACCTCCCTCAACCAGCCATTTGTCCTGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DDR2(4921)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Khairul Anam et al.
Stem cell research & therapy, 4(5), 112-112 (2014-01-11)
Knowing the repertoire of cell signaling receptors would provide pivotal insight into the developmental and regenerative capabilities of bone marrow cell (BMC)-derived hematopoietic stem/progenitor cells (HSPCs) and bone marrow mesenchymal stromal cells (BMMSCs). Murine HSPCs were enriched from fluorescence-activated cell
Shijing Jia et al.
American journal of respiratory cell and molecular biology, 59(3), 295-305 (2018-04-14)
Progressive fibrosis is a complication of many chronic diseases, and collectively, organ fibrosis is the leading cause of death in the United States. Fibrosis is characterized by accumulation of activated fibroblasts and excessive deposition of extracellular matrix proteins, especially type
Mereena George Ushakumary et al.
PloS one, 14(12), e0225911-e0225911 (2019-12-06)
Collagen accumulation and remodeling in the vascular wall is a cardinal feature of vascular fibrosis that exacerbates the complications of hypertension, aging, diabetes and atherosclerosis. With no specific therapy available to date, identification of mechanisms underlying vascular fibrogenesis is an
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU047831-50UG | 04061828321148 |
| EHU047831-20UG | 04061828556366 |