Skip to Content
Merck
CN

EHU048291

MISSION® esiRNA

targeting human RCHY1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACATGCCCAACAGACTTGTGAAGAATGTAGCACATTGTTTGGAGAATATTATTGCGATATATGCCATTTGTTTGACAAAGATAAGAAGCAGTATCACTGTGAAAACTGTGGAATTTGTAGGATTGGTCCAAAGGAAGATTTTTTCCATTGTTTGAAATGTAACTTATGCCTAGCTATGAATCTTCAAGGAAGACACAAGTGTATTGAAAATGTGTCCCGACAGAATTGTCCAATATGTTTGGAGGACATTCACACATCCCGTGTTGTTGCTCATGTCTTGCCATGTGGACATCTTTTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGCTACAGATGTCCATTATGTATGCACTCTGCTTTAGATATGACCAGGTATTGGAGACAGCTGGATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yifeng Bao et al.
Cellular and molecular neurobiology, 37(8), 1501-1509 (2017-03-05)
p53-induced protein with a RING-H2 domain (Pirh2), also known as Rchy1, is an ubiquitin E3 ligase that regulates the turnover and functionality of several proteins involved in cell proliferation and differentiation, cell cycle checkpoints, and cell death. However, it remains
Mina Choi et al.
Biochemical and biophysical research communications, 521(1), 37-41 (2019-10-22)
HDAC2, one of the class I histone deacetylase regulates epigenetic landscape through histone modification. Because HDAC2 is overexpressed in many cancers, cancer therapeutics against HDAC2 have been developed. Here we show novel mechanism of HDAC2 regulation by E3 ligase RCHY1.
Yang Yang-Hartwich et al.
Molecular cancer research : MCR, 17(1), 153-164 (2018-08-23)
Epithelial-mesenchymal transition (EMT) is a critical process involved in cancer metastasis and chemoresistance. Twist1 is a key EMT-inducing transcription factor, which is upregulated in multiple types of cancers and has been shown to promote tumor cell invasiveness and support tumor

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service