Skip to Content
Merck
CN

EHU048931

MISSION® esiRNA

targeting human PIM2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCATCCTCCTCTATGACATGGTGTGTGGGGACATTCCCTTTGAGAGGGACCAGGAGATTCTGGAAGCTGAGCTCCACTTCCCAGCCCATGTCTCCCCAGACTGCTGTGCCCTAATCCGCCGGTGCCTGGCCCCCAAACCTTCTTCCCGACCCTCACTGGAAGAGATCCTGCTGGACCCCTGGATGCAAACACCAGCCGAGGATGTACCCCTCAACCCCTCCAAAGGAGGCCCTGCCCCTTTGGCCTGGTCCTTGCTACCCTAAGCCTGGCCTGGCCTGGCCTGGCCCCCAATGGTCAGAAGAGCCATCCCATGGCCATGTCACAGGGATAGATGGACATTTGTTGACTTGGTTTTACAGGTCATTACCAGTCATTAAAGTCCAGTATTACTAAGGTAAGGGATTGAGGATCAGGGGTTAGAAGACATAAACCAAGTCTGCCCAGTTCCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J R Nair et al.
Leukemia, 31(8), 1715-1726 (2016-12-23)
The PIM kinase family (PIM1, 2 and 3) have a central role in integrating growth and survival signals, and are expressed in a wide range of solid and hematological malignancies. We now confirm that PIM2 is overexpressed in multiple myeloma
Zhaoyun Liu et al.
Oncology letters, 17(6), 5395-5402 (2019-06-13)
PIM2 proto-oncogene, serine/threonine kinase (PIM2) is a serine/threonine protein kinase that is upregulated in different types of cancer and serves essential roles in the regulation of signal transduction cascades, which promote cell survival and cell proliferation. The present study demonstrated
Chune Ren et al.
Molecular oncology, 12(5), 690-704 (2018-03-24)
Tristetraprolin (TTP) is an AU-rich element-binding protein that regulates mRNA stability and plays important roles in cancer. The mechanisms by which TTP is regulated in breast cancer are poorly understood. Using multiple biochemical approaches, we found that proviral insertion in
Tingting Yang et al.
Oncogene, 37(45), 5997-6009 (2018-07-10)
Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service