Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAACTTGCAGAGGAGGAACCCATGGATACAGATCAAGGTAATAGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAATTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTAAAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAGAAAGCTCAGGAAACCAAATGAAGATGTTTTCAGATATGTACACATTTCTGCTTCTGCACATATTTTCATGGAAACCATTATGTATAAAGAACTTAGAGCAACATCCTAATTGGCTCAGTGCACGTTTGGCAATAGTGCCAGCCTGTCTTGTCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UCHL5(51377)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wonhee Han et al.
Scientific reports, 7, 42590-42590 (2017-02-16)
The Tcf/Lef family of transcription factors mediates the Wnt/β-catenin pathway that is involved in a wide range of biological processes, including vertebrate embryogenesis and diverse pathogenesis. Post-translational modifications, including phosphorylation, sumoylation and acetylation, are known to be important for the
Jieru Zhang et al.
Journal of Cancer, 11(22), 6675-6685 (2020-10-14)
Lung cancer is one of the most common malignant tumors in the world, with a high rate of malignancy and mortality. Seeking new biomarkers and potential drug targets is urgent for effective treatment of the disease. Deubiquitinase UCHL5/UCH37, as an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU049401-20UG | 04061828570799 |
| EHU049401-50UG | 04061828335473 |