Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGAACTGGGGCTGGTATTCATGAAAGGCAACTGGGCCCATTCTGGCTTTCCTGAAATTGCATTTGGCCGTTATTCAGATTCCCTGGTGCAGAAGGGCTATAAAGTAGCACGAGTGGAACAGACTGAGACTCCAGAAATGATGGAGGCACGATGTAGAAAGATGGCACATATATCCAAGTATGATAGAGTGGTGAGGAGGGAGATCTGTAGGATCATTACCAAGGGTACACAGACTTACAGTGTGCTGGAAGGTGATCCCTCTGAGAACTACAGTAAGTATCTTCTTAGCCTCAAAGAAAAAGAGGAAGATTCTTCTGGCCATACTCGTGCATATGGTGTGTGCTTTGTTGATACTTCACTGGGAAAGTTTTTCATAGGTCAGTTTTCAGATGATCGCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MSH6(2956)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fumi Higuchi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(7), 1690-1699 (2020-01-05)
Emergence of mismatch repair (MMR) deficiency is a frequent mechanism of acquired resistance to the alkylating chemotherapeutic temozolomide (TMZ) in gliomas. Poly(ADP-ribose) polymerase inhibitors (PARPi) have been shown to potentiate TMZ cytotoxicity in several cancer types, including gliomas. We tested
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU049441-50UG | 04061828335510 |
| EHU049441-20UG | 04061831343335 |