Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCTTCATGCTGGGGACATTCCTCTGGAGCCTCATCGAGTACCTCATCCACCGCTTCCTGTTCCACATGAAGCCCCCCAGCGACAGCTATTACCTCATCATGCTGCACTTCGTCATGCACGGCCAGCACCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCCCCTGTGCCAGCCTCCCTGGTGATCGGCGTCTTCTACTTGTGCATGCAGCTCATCCTGCCCGAGGCAGTAGGGGGCACTGTGTTTGCGGGGGGCCTCCTGGGCTACGTCCTCTATGACATGACCCATTACTACCTGCACTTTGGCTCGCCGCACAAGGGCTCCTACCTGTACAGCCTGAAGGCCCACCACGTCAAGCACCACTTTGCACATCAGAAGTCAGGATTTGGTATCAGCACTAAATTGTGGGATTACTGTTTCCACACCCTCACTCCAGAGAAACCCCACCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FA2H(79152)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Masayo Hirao-Suzuki et al.
Biochemical and biophysical research communications, 531(2), 215-222 (2020-08-17)
The functional role of fatty acid 2-hydroxylase (FA2H) is controversial in the field of cancer biology due to the dual role of FA2H, particularly related to its interaction with triple-negative breast cancer (TNBC). A previous biochemical- and clinical-focused study suggested
Bo Hong et al.
Open medicine (Warsaw, Poland), 15(1), 882-889 (2020-12-22)
MicroRNA (miR/miRNA) expression disorders play a crucial role in the development of gastric cancer (GC). Increasing evidence has indicated that miRNAs participate in the process of numerous cancers. Previous research has demonstrated that miR-300 acts as a cancer-promoting factor or
Janani Ravi et al.
Oncotarget, 5(9), 2475-2486 (2014-05-09)
The endocannabinoid anandamide (AEA), a neurotransmitter was shown to have anti-cancer effects. Fatty acid amide hydrolase (FAAH) metabolizes AEA and decreases its anti-tumorigenic activity. In this study, we have analyzed the role of FAAH inhibition in non-small cell lung cancer
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU049601-20UG | 04061831343380 |
| EHU049601-50UG | 04061828335664 |