Skip to Content
Merck
CN

EHU049731

Sigma-Aldrich

MISSION® esiRNA

targeting human PDS5B

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGCAACCTGGAACATCTCATAACACCATTGGTTACTATTGGTCATATTGCTCTCCTTGCACCTGATCAATTTGCTGCTCCTTTGAAATCTTTGGTAGCTACTTTCATTGTGAAAGATCTTCTCATGAATGATCGGCTTCCAGGGAAAAAGACAACTAAACTTTGGGTTCCAGATGAAGAAGTATCTCCTGAGACAATGGTCAAAATTCAGGCTATTAAAATGATGGTTCGATGGCTACTTGGAATGAAAAATAATCACAGTAAATCAGGAACTTCTACCTTAAGATTGCTAACAACAATATTGCATAGTGATGGAGACTTGACAGAACAGGGGAAAATTAGTAAACCAGATATGTCACGTCTGAGACTTGCTGCTGGGAGTGCTATTGTGAAGCTGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sujuan Xu et al.
Life sciences, 264, 118636-118636 (2020-11-06)
LncRNA HOXB-AS3 is proved as an oncogene in tumors. Herein, we determine the function and mechanism of HOXB-AS3 in epithelial ovarian cancer (EOC) cells. Chi-square test, Kaplan-Meier (KM) analysis and Cox regression analysis were used to analyze the clinicopathological features
Qifang Liu et al.
Infectious agents and cancer, 14, 37-37 (2019-12-14)
It has been reported that lncRNA MAGI2-AS3 can promote many types of cancer, such as breast cancer and bladder cancer, by regulating cell behaviors, such a proliferation, invasion, and migration. However, its role in cervical squamous cell carcinoma (CSCC) is
Gordana Wutz et al.
The EMBO journal, 36(24), 3573-3599 (2017-12-09)
Mammalian genomes are spatially organized into compartments, topologically associating domains (TADs), and loops to facilitate gene regulation and other chromosomal functions. How compartments, TADs, and loops are generated is unknown. It has been proposed that cohesin forms TADs and loops

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service