Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PBK(55872)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
Young-Ju Lee et al.
Biochemical and biophysical research communications, 530(1), 122-129 (2020-08-24)
TGF-β1 is known to induce epithelial-mesenchymal transition (EMT), which is a prerequisite for cancer cell invasion. Here we reveal that TOPK upregulates EMT and invasion of human breast cancer MDA-MB-231 or Hs578T cells via NF-κB-dependent Snail/Slug in TGF-β1 signaling. Endogenous
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU050111-20UG | 04061828571376 |
| EHU050111-50UG | 04061828336142 |