Merck
CN
All Photos(1)

Documents

Safety Information

EHU050311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGS2

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | human accession no.

ENSG00000073756

NCBI accession no.

NM_000963

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTGS2(5743) , PTGS2(5743)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Ke Liao et al.
Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology, 15(3), 390-399 (2019-07-22)
Long non-coding RNAs (lncRNAs), including long intergenic non-coding RNAs (lincRNAs), play an important regulatory role in controlling various biological processes. Both in vitro and in vivo studies have demonstrated that lincRNA-Cox2 plays a global regulatory role in regulating the expression
Denise Philipp et al.
Stem cell research & therapy, 9(1), 286-286 (2018-10-26)
During the last decade, mesenchymal stem cells (MSCs) have gained much attention in the field of regenerative medicine due to their capacity to differentiate into different cell types and to promote immunosuppressive effects. However, the underlying mechanism of MSC-mediated immunoregulation
Sreekanth Chanickal Narayanapillai et al.
Carcinogenesis, 41(11), 1518-1528 (2020-07-01)
Chronic obstructive pulmonary disease (COPD) is a significant risk factor for lung cancer. One potential mechanism through which COPD contributes to lung cancer development could be through generation of an immunosuppressive microenvironment that allows tumor formation and progression. In this
Lei Zhang et al.
Reproduction, fertility, and development (2018-07-10)
Circular RNAs (circRNAs) have been found to play important functional roles in epigenetic regulation under certain physiological and pathological conditions. However, knowledge of circRNAs during the development of receptive endometrium (RE) from pre-RE is limited. In the RE of dairy
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service