Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGAGCGATCGTCTTCTGATCAAAGGAGGTAAAATTGTTAATGATGACCAGTCGTTCTATGCAGACATATACATGGAAGATGGGTTGATCAAGCAAATAGGAGAAAATCTGATTGTGCCAGGAGGAGTGAAGACCATCGAGGCCCACTCCCGGATGGTGATCCCCGGAGGAATTGACGTCCACACTCGTTTCCAGATGCCTGATCAGGGAATGACGTCTGCTGATGATTTCTTCCAAGGAACCAAGGCGGCCCTGGCTGGGGGAACCACTATGATCATTGACCACGTTGTTCCTGAGCCTGGGACAAGCCTGCTCGCTGCCTTTGACCAGTGGAGGGAATGGGCCGACAGCAAGTCCTGCTGTGACTACTCTCTGCATGTGGACATCAGTGAGTGGCATAAGGGCATCCAGGAGGAGATGGAAGCGCTTGTGAAGGATCACGGGGTAAATTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DPYSL2(1808)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hervé Husson et al.
Human molecular genetics, 25(11), 2245-2255 (2016-10-30)
Polycystic kidney diseases (PKDs) comprise a subgroup of ciliopathies characterized by the formation of fluid-filled kidney cysts and progression to end-stage renal disease. A mechanistic understanding of cystogenesis is crucial for the development of viable therapeutic options. Here, we identify
Eun J Na et al.
Frontiers in molecular neuroscience, 10, 288-288 (2017-10-03)
Collapsin response mediator protein (CRMP)-2 and the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway are associated with common physiological functions such as neuronal polarity, axonal outgrowth and synaptic strength, as well as various brain disorders including epilepsy. But
Lokesh Agrawal et al.
Neuropharmacology, 158, 107712-107712 (2019-07-22)
Serotonin (5-HT) homeostasis is critical for the brain development which influences neurogenesis, neuronal migration, and circuit formation. Distinctive distribution patterns of serotonin receptors (5-HTRs) in the brain govern various physiological activities. Amongst the 5-HTRs, serotonin 4 receptor (5-HT4R) is widely
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU050421-50UG | 04061828336449 |
| EHU050421-20UG | 04061828571628 |