Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGGCATTGTCCAGCCTAATGACGGGCAGTGTCATGTTGGTAGTGACAATCATTACTCTGCCTCCACTACCATGGATTATCCCTCTTTGGGGCTGATGACTGAGAAGCTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAAATGTAGTCAATCTCTATCAGAACTATAGTGAGCTCATCCCAGGGACCACAGTTGGGGTTCTGTCCATGGATTCCAGCAATGTCCTCCAGCTCATTGTTGATGCTTATGGGAAAATCCGTTCTAAAGTAGAGCTGGAAGTGCGTGACCTCCCTGAAGAGTTGTCTCTATCCTTCAATGCCACCTGCCTCAACAATGAGGTCATCCCTGGCCTCAAGTCTTGTATGGGACTCAAGATTGGAGACACGGTGAGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGB3(3690)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jing Wu et al.
Journal of cellular physiology, 235(11), 8679-8690 (2020-04-24)
Tumor-associated microglial cells promote glioma growth, invasion, and chemoresistance by releasing inflammatory factors. Milk fat globule EGF factor 8 protein (MFG-E8), a secreted glycoprotein, is closely related to tissue homeostasis and anti-inflammation. In the present study, we investigated the role
Francesco Baschieri et al.
Nature communications, 9(1), 3825-3825 (2018-09-22)
It is generally assumed that cells interrogate the mechanical properties of their environment by pushing and pulling on the extracellular matrix (ECM). For instance, acto-myosin-dependent contraction forces exerted at focal adhesions (FAs) allow the cell to actively probe substrate elasticity.
Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU051661-20UG | 04061831343724 |
| EHU051661-50UG | 04061828322060 |