Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAATAAGGAAACATGTTCACTTATTGACTATTATAGAATGGAACTCAAGGAAATCTGTGTCAGTGGATGCTGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD69(969)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yuki Miyamoto et al.
Nature communications, 7, 13478-13478 (2016-11-24)
Oligodendrocytes differentiate to wrap their plasma membranes around axons, forming the myelin sheath. A neuronal cue is one of the regulator elements controlling this process. Here, we demonstrate that VCAM1, which plays a key role throughout the immune system, is
Haiyan Hu et al.
Molecular medicine reports, 18(3), 3085-3092 (2018-07-18)
Cardiac fibrosis is characterized as net accumulation of ECM (extracellular matrix) proteins in the cardiac interstitium, which contributes to dysfunction of both systolic and diastolic. The present study aimed to identify the association between microRNA (miR)‑367‑3p and cluster of differentiation 69
Lei Yu et al.
Cell death & disease, 9(9), 905-905 (2018-09-07)
Foxp3+ regulatory T cells (Tregs) can inhibit immune responses and maintain immune tolerance by secreting immunosuppressive TGF-β1 and IL-10. However, the efficiency of Tregs become the major obstacle to their use for immunotherapy. In this study, we investigated the relevance
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU051971-20UG | 04061828572915 |
| EHU051971-50UG | 04061828322244 |