Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GATTCTCCAACGACCAGACCATCGAGCTGGAGAAGAAATTCGAGACGCAGAAATATCTCTCTCCGCCCGAGAGGAAGCGTCTGGCCAAGATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTTCAGAATCGACGCGCTAAATGGAGGAGACTAAAACAGGAGAACCCTCAAAGCAATAAAAAAGAAGAACTGGAAAGTTTGGACAGTTCCTGTGATCAGAGGCAAGATTTGCCCAGTGAACAGAATAAAGGTGCTTCTTTGGATAGCTCTCAATGTTCGCCCTCCCCTGCCTCCCAGGAAGACCTTGAATCAGAGATTTCAGAGGATTCTGATCAGGAAGTGGACATTGAGGGCGATAAAAGCTATTTTAATGCTGGATGATGACCACTGGCATTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HHEX(3087)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
R M Kershaw et al.
Oncogenesis, 6(6), e346-e346 (2017-06-13)
Breast tumours progress from hyperplasia to ductal carcinoma in situ (DCIS) and invasive breast carcinoma (IBC). PRH/HHEX (proline-rich homeodomain/haematopoietically expressed homeobox) is a transcription factor that displays both tumour suppressor and oncogenic activity in different disease contexts; however, the role
Eudmar Marcolino et al.
Oncogenesis, 9(2), 10-10 (2020-02-06)
Cancer cells go through a process known as epithelial-mesenchymal transition (EMT) during which they acquire the ability to migrate and invade extracellular matrix. Some cells also acquire the ability to move across a layer of endothelial cells to enter and
Philip Kitchen et al.
Cancer research, 80(4), 757-770 (2019-12-18)
Aberrant Notch and Wnt signaling are known drivers of cholangiocarcinoma (CCA), but the underlying factors that initiate and maintain these pathways are not known. Here, we show that the proline-rich homeodomain protein/hematopoietically expressed homeobox (PRH/HHEX) transcription factor forms a positive
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU052411-50UG | 04061828337705 |
| EHU052411-20UG | 04061828573318 |