Skip to Content
Merck
CN

EHU052551

MISSION® esiRNA

targeting human THBS2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human THBS2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCTGGGTCTATTTGTCTTCTCTCAAGAAATGGTCTATTTCTCAGACCTCAAGTACGAATGCAGAGATATTTAAACAAGATTTGCTGCATTTCCGGCAATGCCCTGTGCATGCCATGGTCCCTAGACACCTCAGTTCATTGTGGTCCTTGTGGCTTCTCTCTCTAGCAGCACCTCCTGTCCCTTGACCTTAACTCTGATGGTTCTTCACCTCCTGCCAGCAACCCCAAACCCAAGTGCCTTCAGAGGATAAATATCAATGGAACTCAGAGATGAACATCTAACCCACTAGAGGAAACCAGTTTGGTGATATATGAGACTTTATGTGGAGTGAAAATTGGGCATGCCATTACATTGCTTTTTCTTGTTTGTTTAAAAAGAATGACGTTTACATATAAAATGTAATTACTTATTGTATTTATGTGTATATGGAGTTGAAGGGAATACTGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Q-H Liu et al.
European review for medical and pharmacological sciences, 22(19), 6230-6238 (2018-10-20)
Thrombospondin 2 (THBS2) expression and its prognostic value have been documented in several types of cancer. Nevertheless, the potential role and clinical significance of THBS2 in uveal melanoma (UM) have never been reported. Thus, in our study, we aimed to
Kyungha Shin et al.
World journal of stem cells, 11(12), 1115-1129 (2019-12-27)
Osteoarthritis (OA), a chronic age-related disease characterized by the slowly progressive destruction of articular cartilage, is one of the leading causes of disability. As a new strategy for treatment of OA, mesenchymal stem cells (MSCs) have the potential for articular
Yingqin Ye et al.
Placenta, 103, 156-163 (2020-11-01)
Circ-AK2 has been found to be differentially expressed in PE placenta tissues, however, the role and the underlying molecular mechanisms of circ-AK2 in PE remain poorly known. The expression of circ-AK2, miR-454-3p, and THBS2 mRNA was detected using quantitative real-time

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service