Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGATTGTCGGCAGAAACAGCCCAGGCGTTGGCAGCAGGGTTAGAACAGCTGCCTGAGGCTCCTCCCTGAAGGACACCTGCCTGAGAGCAGAGATGGAGGCCTTCTGTTCACGGCGGATTCTTTGTTTTAATCTTGCGATGTGCTTTGCTTGTTGCTGGGCGGATGATGTTTACTAACGATGAATTTTACATCCAAAGGGGGATAGGCACTTGGACCCCCATTCTCCAAGGCCCGGGGGGGCGGTTTCCCATGGGATGTGAAAGGCTGGCCATTATTAAGTCCCTGTAACTCAAATGTCAACCCCACCGAGGCACCCCCCCGTCCCCCAGAATCTTGGCTGTTTACAAATCACGTGTCCATCGAGCACGTCTGAAACCCCTGGTAGCCCCGACTTCTTTTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD99(4267)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lais C Cardoso et al.
International journal of molecular sciences, 20(5) (2019-03-09)
Glioblastoma (GBM) is the most aggressive type of brain tumor, with an overall survival of 17 months under the current standard of care therapy. CD99, an over-expressed transmembrane protein in several malignancies, has been considered a potential target for immunotherapy.
Tillmann Bedau et al.
Oncotarget, 8(33), 54873-54888 (2017-09-15)
Transendothelial cell migration (TEM) is crucial for inflammation and metastasis. The adhesion molecule CD99 was shown to be important for correct immune cell extravasation and is highly expressed on certain cancer cells. Recently, we demonstrated that ectodomain shedding of CD99
Jianfa Wu et al.
Biochemical and biophysical research communications, 518(4), 698-705 (2019-09-02)
Cisplatin resistance is a vital obstacle for the prognosis of ovarian cancer. However, the mechanism of cisplatin resistance is still unknown. This research was performed to explore the role of Nrf2 (nuclear factor, erythroid 2 like 2) and CD99 (CD99
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU052611-20UG | 04061828573493 |
| EHU052611-50UG | 04061828337897 |