Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAGGCGTCGACTATAAGAACATCCACCTCGAGAAGAAATATGTCCGCAGGGACAGTGGCTTCTCCAGCCAGGGTGTGGACACCTATGTGGAGATGAGGCCTGTCTCCACTTCTTCAAATGACTCCTTCTCTGAGCAAGACCTGGACAAGGAGGATGGACGGCCCCTGGAGCTCCGGGACCTGCTTCACTTCTCCAGCCAAGTAGCCCAGGGCATGGCCTTCCTCGCTTCCAAGAATTGCATCCACCGGGACGTGGCAGCGCGTAACGTGCTGTTGACCAATGGTCATGTGGCCAAGATTGGGGACTTCGGGCTGGCTAGGGACATCATGAATGACTCCAACTACATTGTCAAGGGCAATGCCCGCCTGCCTGTGAAGTGGATGGCCCCAGAGAGCATCTTTGACTGTGTCTACACGGTTCAGAGCGACGTCTGGTCCTATGGCATCCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CSF1R(1436)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ladonya Jackson et al.
Journal of neuroinflammation, 17(1), 137-137 (2020-04-30)
Unfortunately, over 40% of stroke victims have pre-existing diabetes which not only increases their risk of stroke up to 2-6 fold, but also worsens both functional recovery and the severity of cognitive impairment. Our lab has recently linked the chronic
Thidarath Rattanaburee et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110361-110361 (2020-06-15)
Kusunokinin, a lignan compound, inhibits cancer cell proliferation and induces apoptosis; however, the role of kusunokinin is not fully understood. Here, we aimed to identify a target protein of (-)-kusunokinin and determine the protein levels of its downstream molecules. We
Xiaolong Shi et al.
Cellular and molecular gastroenterology and hepatology, 10(2), 391-418 (2020-04-19)
The miR-34a gene is a direct target of p53 and is commonly silenced in colorectal cancer (CRC). Here we identified the receptor tyrosine kinase CSF1R as a direct miR-34a target and characterized CSF1R as an effector of p53/miR-34a-mediated CRC suppression.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU052661-20UG | 04061828573547 |
| EHU052661-50UG | 04061828337941 |