Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAAGCAAACAATCCAGAGCAGCTGTGCAAACAACGGTGCATAAATGAGGCCTCCTGGACCATGAAGCGAGTCCTGAGCTGCGTCCCGGAGCCCACGGTGGTCATGGCTGCCAGAGCGCTCTGCATGCTGGGGCTGGTCCTGGCCTTGCTGTCCTCCAGCTCTGCTGAGGAGTACGTGGGCCTGTCTGCAAACCAGTGTGCCGTGCCAGCCAAGGACAGGGTGGACTGCGGCTACCCCCATGTCACCCCCAAGGAGTGCAACAACCGGGGCTGCTGCTTTGACTCCAGGATCCCTGGAGTGCCTTGGTGTTTCAAGCCCCTGCAGGAAGCAGAATGCACCTTCTGAGGCACCTCCAGCTGCCCCCGGCCGGGGGATGCGAGGCTCGGAGCACCCTTGCCCGGCTGTGATTGCTGCCAGGCACTGTTCATCTCAGCTTTTCTGTCCCTTTGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TFF3(7033)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Vijay Pandey et al.
Oncotarget, 8(44), 77268-77291 (2017-11-05)
Tamoxifen (TAM) is widely used as an adjuvant therapy for women with breast cancer (BC). However, TAM possesses partial oestrogenic activity in the uterus and its use has been associated with an increased incidence of endometrial carcinoma (EC). The molecular
Ru-Mei Chen et al.
International journal of molecular sciences, 20(24) (2019-12-15)
Increased expression of trefoil factor 3 (TFF3) has been reported in colorectal carcinoma (CRC), being correlated with distant metastasis and poor clinical outcomes. Amongst the CRC subtypes, mesenchymal (CMS4) CRC is associated with the worst survival outcome. Herein, the functional
Qing-Yun Chong et al.
Oncotarget, 8(43), 74188-74208 (2017-11-02)
HER2+/ER+ breast cancer, a subset of the luminal B subtype, makes up approximately 10% of all breast cancers. The bidirectional crosstalk between HER2 and estrogen receptor (ER) in HER2+/ER+ breast cancer contributes to resistance towards both anti-estrogens and HER2-targeted therapies.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU052851-20UG | 04061831343830 |
| EHU052851-50UG | 04061828338122 |