Skip to Content
Merck
CN

EHU052851

Sigma-Aldrich

MISSION® esiRNA

targeting human TFF3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGCAAACAATCCAGAGCAGCTGTGCAAACAACGGTGCATAAATGAGGCCTCCTGGACCATGAAGCGAGTCCTGAGCTGCGTCCCGGAGCCCACGGTGGTCATGGCTGCCAGAGCGCTCTGCATGCTGGGGCTGGTCCTGGCCTTGCTGTCCTCCAGCTCTGCTGAGGAGTACGTGGGCCTGTCTGCAAACCAGTGTGCCGTGCCAGCCAAGGACAGGGTGGACTGCGGCTACCCCCATGTCACCCCCAAGGAGTGCAACAACCGGGGCTGCTGCTTTGACTCCAGGATCCCTGGAGTGCCTTGGTGTTTCAAGCCCCTGCAGGAAGCAGAATGCACCTTCTGAGGCACCTCCAGCTGCCCCCGGCCGGGGGATGCGAGGCTCGGAGCACCCTTGCCCGGCTGTGATTGCTGCCAGGCACTGTTCATCTCAGCTTTTCTGTCCCTTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qing-Yun Chong et al.
Oncotarget, 8(43), 74188-74208 (2017-11-02)
HER2+/ER+ breast cancer, a subset of the luminal B subtype, makes up approximately 10% of all breast cancers. The bidirectional crosstalk between HER2 and estrogen receptor (ER) in HER2+/ER+ breast cancer contributes to resistance towards both anti-estrogens and HER2-targeted therapies.
Ru-Mei Chen et al.
International journal of molecular sciences, 20(24) (2019-12-15)
Increased expression of trefoil factor 3 (TFF3) has been reported in colorectal carcinoma (CRC), being correlated with distant metastasis and poor clinical outcomes. Amongst the CRC subtypes, mesenchymal (CMS4) CRC is associated with the worst survival outcome. Herein, the functional
Vijay Pandey et al.
Oncotarget, 8(44), 77268-77291 (2017-11-05)
Tamoxifen (TAM) is widely used as an adjuvant therapy for women with breast cancer (BC). However, TAM possesses partial oestrogenic activity in the uterus and its use has been associated with an increased incidence of endometrial carcinoma (EC). The molecular
Akanchha Shukla et al.
Biochemical and biophysical research communications, 499(4), 829-835 (2018-04-06)
Glioblastomas (GBMs) are characterized by the metabolic shift towards aerobic glycolysis, rapid proliferation and acquisition of the migratory and invasive phenotype aiding tumor angiogenesis. The glycolytic inhibitor 2-Deoxy-d-glucose (2-DG) used for targeting glycolysis in GBMs is ineffective in inhibiting migration
Jieying Liu et al.
Experimental & molecular medicine, 50(8), 110-110 (2018-08-25)
The overexpression of trefoil factor family 3 (TFF3) is observed in a variety of cancers, including prostate cancer (PCa), and its potential role in carcinogenesis, such as activating the PI3K/AKT pathway, is suggested. However, its role and its related mechanisms

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service